Kevin McKernan’s company Medicinal Genomics announced that it has a draft assembly of the marijuana genome, reports Bloomberg. The data is to be posted to the Amazon EC2 cloud. According to Natu… more →
Bio Sagawrote 8 hours ago: There have recently been a swath cut across the country when a number of incidents have cause myster … more →
wrote 1 day ago: Are you eating enough? Is your diet balanced? Do you meet you recommended daily allowance of various … more →
wrote 1 day ago: A tomato (left), chosen at random from a vegetable cart in New York City, tested as having a conside … more →
wrote 1 day ago: Thinkers tend to refer to the “bed, the bath, and the bus” as places where they get thei … more →
wrote 2 days ago: … more →
wrote 3 days ago: The previous Kamilah the gorilla story leads us – where else – to the Naked Mole Rat. Addicted Natur … more →
wrote 4 days ago: New publication from the Albert Einstein College of Medicine, indicates that if you live a long life … more →
wrote 4 days ago: Between 5-15 % of the European and US population will be affected by RLS. Most of my family have som … more →
wrote 4 days ago: GenomEgo - Art Piece The personal lifetime risks of several relavant conditions and traits for a mal … more →
wrote 1 week ago: Since I brought up Darwin in the last post, it seemed obvious that I would follow it with one about … more →
wrote 1 week ago: Miscanthus grasses are used in gardens, burned for heat and energy, and converted into liquid fuels. … more →
wrote 1 week ago: Nanotechnology meets whole genome sequencing – perhaps this will allow doctors to sequence you … more →
wrote 1 week ago: … more →
wrote 1 week ago: Analogous to the advent of the computer, whole genome sequencing is becoming cheaper and cheaper to … more →
wrote 2 weeks ago: A transgenic organism is an organism which has been modified with genetic material from another spec … more →
wrote 2 weeks ago: gaggttggctcgatgctgttcccaggtactgttgttggctgttggtgaggaaggtgaagcactcagttgccttctcggg cctcggcgccccctatgta … more →
wrote 2 weeks ago: Download a podcast of Associate Professor Johannes Krause presentation titled, ‘The Genome of the Bl … more →
wrote 2 weeks ago: Tau Gets Tricky ..One of her current areas of interest is the development of neurofibrillary tangles … more →
wrote 2 weeks ago: Image of: Biotech targets fight back as Big Pharma circles Biotech companies are fighting back in an … more →