Blogs about: Genome
Featured Blog
Marijuana genome
Kevin McKernan’s company Medicinal Genomics announced that it has a draft assembly of the marijuana genome, reports Bloomberg. The data is to be posted to the Amazon EC2 cloud. According to Natu… more →
Bio Saga
Could HAZMAT incidents be related to Zombie Epidemic?
wrote 8 hours ago: There have recently been a swath cut across the country when a number of incidents have cause myster … more →
You are what you eat: your diet could affect generations of descendants
wrote 1 day ago: Are you eating enough? Is your diet balanced? Do you meet you recommended daily allowance of various … more →
Tomato Genome Shocker! Tomato Has Higher IQ Than Donald Trump
— 5 comments
wrote 1 day ago: A tomato (left), chosen at random from a vegetable cart in New York City, tested as having a conside … more →
The Bed, the Bath, the Bus---and the Motorcycle: Where Craig Venter Gets His Ideas
wrote 1 day ago: Thinkers tend to refer to the “bed, the bath, and the bus” as places where they get thei … more →
What's the Difference Between Us???
wrote 2 days ago: … more →
Not getting cancer: a sequel to sequencing and evolution
— 1 comment
wrote 3 days ago: The previous Kamilah the gorilla story leads us – where else – to the Naked Mole Rat. Addicted Natur … more →
If you are optimistic, smiles easily, have high levels of good cholesterol in your blood, you might hit the 95 years of age bar...
wrote 4 days ago: New publication from the Albert Einstein College of Medicine, indicates that if you live a long life … more →
Restless Leg Syndrome - It is all about moving your limbs...
wrote 4 days ago: Between 5-15 % of the European and US population will be affected by RLS. Most of my family have som … more →
GenomEGO is now finally finished and has been exhibited at the Medical Museion, Cph 24th of May 2012.
wrote 4 days ago: GenomEgo - Art Piece The personal lifetime risks of several relavant conditions and traits for a mal … more →
Nature vs Nurture. Time to end the debate
— 2 comments
wrote 1 week ago: Since I brought up Darwin in the last post, it seemed obvious that I would follow it with one about … more →
Maps of Miscanthus Genome Offer Insight Into Grass Evolution
wrote 1 week ago: Miscanthus grasses are used in gardens, burned for heat and energy, and converted into liquid fuels. … more →
The doctor will see your genome now...
wrote 1 week ago: Nanotechnology meets whole genome sequencing – perhaps this will allow doctors to sequence you … more →
Will There Be An Information-Age-Tollbooth In The Near Future?
wrote 1 week ago: … more →
The Cinematography of Personalized Medicine
wrote 1 week ago: Analogous to the advent of the computer, whole genome sequencing is becoming cheaper and cheaper to … more →
What Are Transgenic Organisms?
wrote 2 weeks ago: A transgenic organism is an organism which has been modified with genetic material from another spec … more →
Genomics: "Let Us Pray"
wrote 2 weeks ago: gaggttggctcgatgctgttcccaggtactgttgttggctgttggtgaggaaggtgaagcactcagttgccttctcggg cctcggcgccccctatgta … more →
ACAD Guest speaker: Johannes Krause - Podcast now available
wrote 2 weeks ago: Download a podcast of Associate Professor Johannes Krause presentation titled, ‘The Genome of the Bl … more →
Medscape: Four Upcoming Breakthroughs in Neurology?
wrote 2 weeks ago: Tau Gets Tricky ..One of her current areas of interest is the development of neurofibrillary tangles … more →
Biotech targets fight back as Big Pharma circles
wrote 2 weeks ago: Image of: Biotech targets fight back as Big Pharma circles Biotech companies are fighting back in an … more →
