Tags » Nona

details nonA knock-in construct

start with knock-out construct for cloning (which already has homology arms); use PA-62 (EA) and VAPW-54 (EB) DNA for PCR. PCR primers with BspE1 restriction site; clone into AgeI of vector. 127 more words

NonA

details knock-out construct

Use pHD_DsRed_attP plasmid (from Addgene) for cloning; use PA-62 (EA) and VAPW-54 (EB) DNA for PCR.

4/6/15 – PCR homology arm 1 with Phusion High Fidelity DNA polymerase; clean PCR product with QIAquick PCR purification kit, for_primer: ATGCCACCTGCATGCTCGCTGCTACACTTCGTCTTGTGCT; rev_primer: ATGCCACCTGCATGCCTACTATTACTAGCTAACGAGGACA; 110 more words

NonA

nonA transgenics overview

I finished my nonA transgenic constructs today. I used the pHD-DsRed-attP vector for cloning, and strains PA-52 (EA semispecies) and VAPW54 (EB semispecies) for cloning homology arms and the… 129 more words

NonA

My Thoughts: Death Parade

So after reading a review of “Death Parade” from the wordpress blog Boy Meets Anime I decided I’d give it a chance since it seemed to have an almost BTOOOM! 646 more words

Otaku

Nona Agogo

Tahun enam puluhan, tujuh puluhan yang namanya nona Agogo bekèn banget, lagu nya yang ada kata-kata “rambut disasak kayak singa, naik mobil merèk impala…”
Ciee, cieee… 165 more words

Happy Life

Anime'd Out

Anime North was a great success, thanks to everyone who came out to our booth!

Chin Up

Evie's Kitchen

I could definitely describe yesterday in one word..Vivacious! Our sweet home was full of giggles, and imaginations running free. Playing in the sprinklers and sand box too making fairy boats out of leaves and grass for oars as I was tending to the garden. 421 more words